Orthologous regulated operons containing CJA_1840 gene

Properties
Regulog:	CadR-PbrR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -63 Score: 6.1543 Sequence: ACCCTCTAGTAACTATAGAGT Locus tag: CJA_1839 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: CJA_1840 Name: null Funciton: hypothetical protein Locus tag: CJA_1841 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: CJA_1842 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: CJA_1843 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
czcD-CJA_1840-czcC-czcB-czcA	-63	6.2	ACCCTCTAGTAACTATAGAGT	CJA_1839

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --