Orthologous regulated operons containing czcD gene
| Regulog: | CadR-PbrR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -58
Score: 5.54752 Sequence: ACCCTGTAGCGACTCCAGACT
Locus tag: HCH_03680
Name: czcD Funciton: Co/Zn/Cd efflux protein |
||||
| czcD | -58 | 5.5 | ACCCTGTAGCGACTCCAGACT | HCH_03680 |
| Marinobacter aqueolei | ||||
|
Position: -55
Score: 6.58312 Sequence: ACCCTGTAGCAACTACAGGGT
Locus tag: Maqu_3109
Name: czcD Funciton: Co/Zn/Cd efflux protein |
||||
| czcD | -55 | 6.6 | ACCCTGTAGCAACTACAGGGT | Maqu_3109 |
| Marinobacter sp. ELB17 | ||||
|
Position: -57
Score: 6.58312 Sequence: ACCCTGTAGCTACTACAGGGT
Locus tag: MELB17_04522
Name: czcD Funciton: Co/Zn/Cd efflux protein |
||||
| czcD | -57 | 6.6 | ACCCTGTAGCTACTACAGGGT | MELB17_04522 |
| Oceanospirillum sp. MED92 | ||||
|
Position: -59
Score: 6.52076 Sequence: ACCCTATAGCTACTACAGGGT
Locus tag: MED92_00235
Name: czcD Funciton: Co/Zn/Cd efflux protein |
||||
| czcD | -59 | 6.5 | ACCCTATAGCTACTACAGGGT | MED92_00235 |