Orthologous regulated operons containing Patl_2026 gene

Properties
Regulog:	CadR-PbrR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Glaciecola sp. HTCC2999
Position: -78 Score: 5.15573 Sequence: ACCCTATACTTGGTATAGAGT Locus tag: GHTCC_010100000540 Name: null Funciton: hypothetical protein Locus tag: GHTCC_010100000545 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: GHTCC_010100000550 Name: null Funciton: hypothetical protein Locus tag: GHTCC_010100000555 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: GHTCC_010100000560 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: GHTCC_010100000565 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
GHTCC_010100000540-czcD-GHTCC_010100000550-czcC-czcB-czcA	-78	5.2	ACCCTATACTTGGTATAGAGT	GHTCC_010100000540
Pseudoalteromonas atlantica T6c
Position: -60 Score: 4.56606 Sequence: ACTCTATACTTAGTATAGACT Locus tag: Patl_2025 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Patl_2026 Name: null Funciton: hypothetical protein Locus tag: Patl_2027 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Patl_2028 Name: null Funciton: hypothetical protein Locus tag: Patl_2029 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: Patl_2030 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: Patl_2031 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
czcD-Patl_2026-czcD-Patl_2028-czcC-czcB-czcA	-60	4.6	ACTCTATACTTAGTATAGACT	Patl_2025

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --