Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing czcA gene

Properties
Regulog: CadR-PbrR - Alteromonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Glaciecola sp. HTCC2999
Position: -78
Score: 5.15573
Sequence: ACCCTATACTTGGTATAGAGT
Locus tag: GHTCC_010100000540
Name: null
Funciton: hypothetical protein
Locus tag: GHTCC_010100000545
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: GHTCC_010100000550
Name: null
Funciton: hypothetical protein
Locus tag: GHTCC_010100000555
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: GHTCC_010100000560
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: GHTCC_010100000565
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
GHTCC_010100000540-czcD-GHTCC_010100000550-czcC-czcB-czcA -78 5.2 ACCCTATACTTGGTATAGAGT GHTCC_010100000540
Idiomarina baltica OS145
Position: -61
Score: 5.49582
Sequence: ACCTTATAGTAGCTTTATAGT
Locus tag: OS145_01757
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: OS145_01752
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
Locus tag: OS145_01747
Name: null
Funciton: hypothetical protein
Locus tag: OS145_01742
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: OS145_01737
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: OS145_01732
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
czcD-lspA-OS145_01747-czcC-czcB-czcA -61 5.5 ACCTTATAGTAGCTTTATAGT OS145_01757
Pseudoalteromonas atlantica T6c
Position: -60
Score: 4.56606
Sequence: ACTCTATACTTAGTATAGACT
Locus tag: Patl_2025
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Patl_2026
Name: null
Funciton: hypothetical protein
Locus tag: Patl_2027
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Patl_2028
Name: null
Funciton: hypothetical protein
Locus tag: Patl_2029
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: Patl_2030
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Patl_2031
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
czcD-Patl_2026-czcD-Patl_2028-czcC-czcB-czcA -60 4.6 ACTCTATACTTAGTATAGACT Patl_2025
Pseudoalteromonas haloplanktis TAC125
Position: -93
Score: 5.18325
Sequence: ACCTTCCAGTAACTAGAAGGT
Locus tag: PSHAa0576
Name: ATW7_03852
Funciton: conserved protein of unknown function
Locus tag: PSHAa0577
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: PSHAa0578
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: PSHAa0579
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
ATW7_03852-czcC-czcB-czcA -93 5.2 ACCTTCCAGTAACTAGAAGGT PSHAa0576