Orthologous regulated operons containing ATW7_03852 gene
| Regulog: | CadR-PbrR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudoalteromonas haloplanktis TAC125 | ||||
|
Position: -93
Score: 5.18325 Sequence: ACCTTCCAGTAACTAGAAGGT
Locus tag: PSHAa0576
Name: ATW7_03852 Funciton: conserved protein of unknown function
Locus tag: PSHAa0577
Name: czcC Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: PSHAa0578
Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: PSHAa0579
Name: czcA Funciton: Heavy metal efflux RND transmembrane protein |
||||
| ATW7_03852-czcC-czcB-czcA | -93 | 5.2 | ACCTTCCAGTAACTAGAAGGT | PSHAa0576 |