Orthologous regulated operons containing cadA gene

Properties
Regulog:	CadR-PbrR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -59 Score: 6.35953 Sequence: ACTCTATAGTAACTACAGAGT Locus tag: Sputcn32_1972 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Sputcn32_1971 Name: null Funciton: hypothetical protein Locus tag: Sputcn32_1970 Name: czcC Funciton: Heavy metal RND efflux outer membrane protein Locus tag: Sputcn32_1969 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: Sputcn32_1968 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein Locus tag: Sputcn32_1967 Name: null Funciton: hypothetical protein Locus tag: Sputcn32_1966 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
czcD-Sputcn32_1971-czcC-czcB-czcA-Sputcn32_1967-cadA	-59	6.4	ACTCTATAGTAACTACAGAGT	Sputcn32_1972

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --