Orthologous regulated operons containing Sputcn32_0228 gene
| Regulog: | CadR-PbrR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella putrefaciens CN-32 | ||||
|
Position: -59
Score: 6.35953 Sequence: ACTCTATAGTAACTACAGAGT
Locus tag: Sputcn32_1972
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputcn32_1971
Name: null Funciton: hypothetical protein
Locus tag: Sputcn32_1970
Name: czcC Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: Sputcn32_1969
Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sputcn32_1968
Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
Locus tag: Sputcn32_1967
Name: null Funciton: hypothetical protein
Locus tag: Sputcn32_1966
Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
||||
| czcD-Sputcn32_1971-czcC-czcB-czcA-Sputcn32_1967-cadA | -59 | 6.4 | ACTCTATAGTAACTACAGAGT | Sputcn32_1972 |
| Shewanella sp W3-18-1 | ||||
|
Position: -59
Score: 6.35953 Sequence: ACTCTATAGTAACTACAGAGT
Locus tag: Sputw3181_1169
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputw3181_1168
Name: null Funciton: hypothetical protein
Locus tag: Sputw3181_1167
Name: czcC Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: Sputw3181_1166
Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sputw3181_1165
Name: czcA Funciton: Heavy metal efflux RND transmembrane protein |
||||
| czcD-Sputw3181_1168-czcC-czcB-czcA | -59 | 6.4 | ACTCTATAGTAACTACAGAGT | Sputw3181_1169 |