Orthologous regulated operons containing czcD gene
Regulog: | CadR-PbrR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Lead resistance; Cadmium resistance |
Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella putrefaciens CN-32 | ||||
Position: -59
Score: 6.35953 Sequence: ACTCTATAGTAACTACAGAGT
Locus tag: Sputcn32_1972
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputcn32_1971
Name: null Funciton: hypothetical protein
Locus tag: Sputcn32_1970
Name: czcC Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: Sputcn32_1969
Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sputcn32_1968
Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
Locus tag: Sputcn32_1967
Name: null Funciton: hypothetical protein
Locus tag: Sputcn32_1966
Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
||||
czcD-Sputcn32_1971-czcC-czcB-czcA-Sputcn32_1967-cadA | -59 | 6.4 | ACTCTATAGTAACTACAGAGT | Sputcn32_1972 |
Shewanella sp ANA-3 | ||||
Position: -57
Score: 6.29717 Sequence: ACTCTATAGTAACTATAGAGT
Locus tag: Shewana3_4157
Name: czcD Funciton: Co/Zn/Cd efflux protein |
||||
czcD | -57 | 6.3 | ACTCTATAGTAACTATAGAGT | Shewana3_4157 |
Shewanella sp W3-18-1 | ||||
Position: -59
Score: 6.35953 Sequence: ACTCTATAGTAACTACAGAGT
Locus tag: Sputw3181_1169
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputw3181_1168
Name: null Funciton: hypothetical protein
Locus tag: Sputw3181_1167
Name: czcC Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: Sputw3181_1166
Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sputw3181_1165
Name: czcA Funciton: Heavy metal efflux RND transmembrane protein |
||||
czcD-Sputw3181_1168-czcC-czcB-czcA | -59 | 6.4 | ACTCTATAGTAACTACAGAGT | Sputw3181_1169 |