Orthologous regulated operons containing lspA gene

Properties
Regulog:	CadR-PbrR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella frigidimarina NCIMB 400
Position: -61 Score: 5.84283 Sequence: ACTCTATAGTGACTATAGAGA Locus tag: Sfri_3462 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Locus tag: Sfri_3463 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
cadA-lspA	-61	5.8	ACTCTATAGTGACTATAGAGA	Sfri_3462

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --