Orthologous regulated operons containing lspA gene

Properties
Regulog:	CadR-PbrR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -61 Score: 5.61753 Sequence: ACCTTATAGTGACTTTATAGT Locus tag: Sputcn32_0195 Name: czcD2 Funciton: Co/Zn/Cd efflux protein Locus tag: Sputcn32_0196 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2-lspA	-61	5.6	ACCTTATAGTGACTTTATAGT	Sputcn32_0195
Shewanella sp W3-18-1
Position: -61 Score: 5.61753 Sequence: ACCTTATAGTGACTTTATAGT Locus tag: Sputw3181_0520 Name: czcD2 Funciton: Co/Zn/Cd efflux protein Locus tag: Sputw3181_0519 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2-lspA	-61	5.6	ACCTTATAGTGACTTTATAGT	Sputw3181_0520

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --