Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing merA gene

Properties
Regulog: MerR - Burkholderia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Beta
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia glumae BGR1
Position: -152
Score: 5.98822
Sequence: ACTCCGTAGTCGACTACGGAAG
Locus tag: bglu_2p0790
Name: merC
Funciton: Mercury uptake inner membane protein
Locus tag: bglu_2p0780
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
merC-merA -152 6 ACTCCGTAGTCGACTACGGAAG bglu_2p0790
Burkholderia xenovorans LB400
Position: -63
Score: 6.1447
Sequence: ACTCCGTACATGACTACGGAAG
Locus tag: Bxe_C1216
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: Bxe_C1215
Name: merP
Funciton: Periplasmic mercury (+2) binding protein
Locus tag: Bxe_C1214
Name: merC
Funciton: Mercury uptake inner membane protein
Locus tag: Bxe_C1213
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: Bxe_C1212
Name: merD
Funciton: Mercuric resistance operon coregulator
Locus tag: Bxe_C1211
Name: merE
Funciton: Putative mercury resistance protein
merT-merP-merC-merA-merD-merE -63 6.1 ACTCCGTACATGACTACGGAAG Bxe_C1216
© 2009-2020 RegPrecise