Orthologous regulated operons containing thl2 gene
Regulog: | BglR - Sphingomonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Beta-glucosides utilization |
Effector: | Beta-glucoside; Glucose |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Novosphingobium aromaticivorans DSM 12444 | ||||
Position: -78
Score: 5.72672 Sequence: CTGCGTGAACGTTCTCATAT
Position: -60
Score: 5.98533 Sequence: ATAGGTGAACGTTCACAACA
Locus tag: Saro_1603
Name: omp(Bgl) Funciton: TonB-dependent outer membrane transporter for beta-glucosides
Locus tag: Saro_1604
Name: thl1 Funciton: tryptophan halogenase, putative
Locus tag: Saro_1605
Name: sapC Funciton: Peptide transport system permease protein sapC (TC 3.A.1.5.5)
Locus tag: Saro_1606
Name: Sala_0917 Funciton: Pass1-related protein
Locus tag: Saro_1607
Name: thl2 Funciton: tryptophan halogenase, putative
Locus tag: Saro_1608
Name: bglA Funciton: Glucan endo-1,3-beta-D-glucosidase
Locus tag: Saro_1609
Name: bglR Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family
Locus tag: Saro_1610
Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily |
||||
omp(Bgl)-thl1-sapC-Sala_0917-thl2-bglA-bglR-bglT | -78 | 5.7 | CTGCGTGAACGTTCTCATAT | Saro_1603 |
-60 | 6 | ATAGGTGAACGTTCACAACA | ||
Sphingopyxis alaskensis RB2256 | ||||
Position: -84
Score: 5.29717 Sequence: CGAAGTGAACGTTATCATTT
Position: -66
Score: 6.04402 Sequence: TTACGTGAACGTTCACAATC
Locus tag: Sala_0914
Name: omp(Bgl) Funciton: TonB-dependent outer membrane transporter for beta-glucosides
Locus tag: Sala_0915
Name: thl1 Funciton: tryptophan halogenase, putative
Locus tag: Sala_0916
Name: sapC Funciton: Peptide transport system permease protein sapC (TC 3.A.1.5.5)
Locus tag: Sala_0917
Name: Sala_0917 Funciton: Pass1-related protein
Locus tag: Sala_0918
Name: thl2 Funciton: tryptophan halogenase, putative
Locus tag: Sala_0919
Name: bglA Funciton: Glucan endo-1,3-beta-D-glucosidase
Locus tag: Sala_0920
Name: bglR Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family
Locus tag: Sala_0921
Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily |
||||
omp(Bgl)-thl1-sapC-Sala_0917-thl2-bglA-bglR-bglT | -84 | 5.3 | CGAAGTGAACGTTATCATTT | Sala_0914 |
-66 | 6 | TTACGTGAACGTTCACAATC |