Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing h16_B0904 gene

Properties
Regulog: MerR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Beta
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia eutropha H16
Position: -142
Score: 6.26364
Sequence: ACTCCGTACCTTGGTACGGACC
Locus tag: H16_B0904
Name: h16_B0904
Funciton: hypothetical protein
Locus tag: H16_B0905
Name: h16_B0905
Funciton: hypothetical protein
h16_B0904-h16_B0905 -142 6.3 ACTCCGTACCTTGGTACGGACC H16_B0904
© 2009-2020 RegPrecise