Orthologous regulated operons containing merD gene

Properties
Regulog:	MerR - Ralstonia
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/Beta

Built upon 11 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Ralstonia eutropha JMP134
Position: -63 Score: 6.32826 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: pJP4_52 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: pJP4_51 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: pJP4_50 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: pJP4_49 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: pJP4_48 Name: merE Funciton: Putative mercury resistance protein
merT-merP-merA-merD-merE	-63	6.3	ACTCCGTACATGAGTACGGAAG	pJP4_52
Ralstonia metallidurans CH34
Position: -63 Score: 6.32826 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: RMe0107 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: RMe0106 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: RMe0105 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: RMe0104 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: RMe0103 Name: merE Funciton: Putative mercury resistance protein
merT-merP-merA-merD-merE	-63	6.3	ACTCCGTACATGAGTACGGAAG	RMe0107
Ralstonia pickettii 12J
Position: -63 Score: 6.06052 Sequence: ACTCCGTACAACAGTACGGAAG Locus tag: Rpic_1784 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Rpic_1785 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: Rpic_1786 Name: merC Funciton: Mercury uptake inner membane protein Locus tag: Rpic_1787 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: Rpic_1788 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: Rpic_1789 Name: merB Funciton: Organomercurial lyase
merT-merP-merC-merA-merD-merB	-63	6.1	ACTCCGTACAACAGTACGGAAG	Rpic_1784