Orthologous regulated operons containing hisY gene
| Regulog: | HisR - Clostridia-3 |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Histidine biosynthesis |
| Effector: | Histidine |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Blautia hansenii DSM 20583 | ||||
|
Position: -61
Score: 4.43487 Sequence: CAATTTAGCATAGTAGAGAA
Locus tag: BLAHAN_01245
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: BLAHAN_01244
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: BLAHAN_01243
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -61 | 4.4 | CAATTTAGCATAGTAGAGAA | BLAHAN_01245 |
| Clostridiales bacterium 1_7_47_FAA | ||||
|
Position: -59
Score: 5.59425 Sequence: CACTTTAGTGTGCTAATATG
Locus tag: Cbac1_010100022442
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: Cbac1_010100022447
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: Cbac1_010100022452
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -59 | 5.6 | CACTTTAGTGTGCTAATATG | Cbac1_010100022442 |
| Clostridium bolteae ATCC BAA-613 | ||||
|
Position: -25
Score: 5.26759 Sequence: CGCTTTAGTGTGCTAATATG
Locus tag: CLOBOL_01668
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: CLOBOL_01669
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: CLOBOL_01670
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -25 | 5.3 | CGCTTTAGTGTGCTAATATG | CLOBOL_01668 |
| Clostridium nexile DSM 1787 | ||||
|
Position: -54
Score: 4.82891 Sequence: TAATTTAGTGTGGTAGAGTA
Locus tag: CLONEX_03079
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: CLONEX_03078
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: CLONEX_03077
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -54 | 4.8 | TAATTTAGTGTGGTAGAGTA | CLONEX_03079 |
| Clostridium scindens ATCC 35704 | ||||
|
Position: -91
Score: 5.59682 Sequence: CAATTTAGCGTGGTAAAGTA
Locus tag: CLOSCI_00784
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: CLOSCI_00783
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: CLOSCI_00782
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -91 | 5.6 | CAATTTAGCGTGGTAAAGTA | CLOSCI_00784 |
| Dorea formicigenerans ATCC 27755 | ||||
|
Position: -154
Score: 5.27016 Sequence: CGATTTAGCGTGGTAAAGTA
Locus tag: DORFOR_00662
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: DORFOR_00661
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: DORFOR_00660
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -154 | 5.3 | CGATTTAGCGTGGTAAAGTA | DORFOR_00662 |
| Dorea longicatena DSM 13814 | ||||
|
Position: -94
Score: 5.22472 Sequence: GATTTTAGTGTGATAAAGTA
Locus tag: DORLON_00748
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: DORLON_00747
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: DORLON_00746
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -94 | 5.2 | GATTTTAGTGTGATAAAGTA | DORLON_00748 |
| Eubacterium rectale ATCC 33656 | ||||
|
Position: -83
Score: 5.16519 Sequence: TACTTTAGCGTGATAATTTG
Locus tag: EUBREC_2005
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: EUBREC_2004
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: EUBREC_2003
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -83 | 5.2 | TACTTTAGCGTGATAATTTG | EUBREC_2005 |
| Ruminococcus gnavus ATCC 29149 | ||||
|
Position: -64
Score: 5.52734 Sequence: CAGTTTAGTATAGTAAAGTG
Locus tag: RUMGNA_00302
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: RUMGNA_00303
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: RUMGNA_00304
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -64 | 5.5 | CAGTTTAGTATAGTAAAGTG | RUMGNA_00302 |
| Ruminococcus lactaris ATCC 29176 | ||||
|
Position: -70
Score: 4.59371 Sequence: GACTTTACCATGGTGCAGTG
Locus tag: RUMLAC_01337
Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: RUMLAC_01338
Name: hisY Funciton: Histidine ABC transporter, permease protein
Locus tag: RUMLAC_01339
Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein |
||||
| hisX-hisY-hisZ | -70 | 4.6 | GACTTTACCATGGTGCAGTG | RUMLAC_01337 |