Orthologous regulated operons containing COG2303 gene
Regulog: | RL4253 - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Rhizobium sp. NGR234 | ||||
Position: -129
Score: 6.21277 Sequence: GATTTGTAACGTTTTAAATT
Locus tag: NGR_c33060
Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component
Locus tag: NGR_c33070
Name: RL4251 Funciton: sugar ABC transporter, permease protein
Locus tag: NGR_c33080
Name: RL4250 Funciton: sugar ABC transporter, permease protein
Locus tag: NGR_c33090
Name: RL4249 Funciton: sugar ABC transporter, ATP-binding protein
Locus tag: NGR_c33110
Name: COG2303 Funciton: Choline dehydrogenase and related flavoproteins |
||||
RL4252-RL4251-RL4250-RL4249-COG2303 | -129 | 6.2 | GATTTGTAACGTTTTAAATT | NGR_c33060 |