Orthologous regulated operons containing usp gene

Properties
Regulog:	SPO0590 - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 21 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -281 Score: 5.7057 Sequence: AATTGTAACAGCTTACATTG Locus tag: Jann_1349 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: Jann_1350 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: Jann_1351 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: Jann_1352 Name: usp Funciton: Universal stress family protein
dctP-dctQ-dctM-usp	-281	5.7	AATTGTAACAGCTTACATTG	Jann_1349
Roseobacter sp. MED193
Position: -298 Score: 6.08106 Sequence: CAATGTAAGGGCTTGCATAA Position: -275 Score: 6.67598 Sequence: CCATGTAAGCGCTTACATTG Locus tag: MED193_17079 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: MED193_17074 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: MED193_17069 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: MED193_17064 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: MED193_17059 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: MED193_17054 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: MED193_17049 Name: usp Funciton: Universal stress family protein Locus tag: MED193_17044 Name: comD Funciton: Sulfopyruvate decarboxylase - alpha subunit (EC 4.1.1.79) Locus tag: MED193_17039 Name: comE Funciton: Sulfopyruvate decarboxylase - beta subunit (EC 4.1.1.79) Locus tag: MED193_17034 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
dctP-dctQ-dctM-hisD1-gno-sdh-usp-comD-comE-ldh	-298	6.1	CAATGTAAGGGCTTGCATAA	MED193_17079
	-275	6.7	CCATGTAAGCGCTTACATTG
Roseovarius nubinhibens ISM
Position: -109 Score: 6.21981 Sequence: AAATGTAAGCGCTTGCAATA Position: -86 Score: 6.50367 Sequence: CCATGCAAGCGCTTACATTG Locus tag: ISM_05010 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: ISM_05015 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: ISM_05020 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: ISM_05025 Name: usp Funciton: Universal stress family protein
hisD1-gno-sdh-usp	-109	6.2	AAATGTAAGCGCTTGCAATA	ISM_05010
	-86	6.5	CCATGCAAGCGCTTACATTG
Roseovarius sp. 217
Position: -265 Score: 6.64346 Sequence: ATATGTAAGCGCTTACATTT Locus tag: ROS217_11206 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: ROS217_11211 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: ROS217_11216 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: ROS217_11221 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: ROS217_11226 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: ROS217_11231 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: ROS217_11236 Name: usp Funciton: Universal stress family protein Locus tag: ROS217_11241 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
dctP-dctQ-dctM-hisD1-gno-sdh-usp-ldh	-265	6.6	ATATGTAAGCGCTTACATTT	ROS217_11206
Silicibacter pomeroyi DSS-3
Position: -292 Score: 5.60383 Sequence: GCGTGTAAGCGCTTGCATCG Position: -270 Score: 6.85773 Sequence: AAATGTAAGCGCTTACATTG Locus tag: SPO0591 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: SPO0592 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: SPO0593 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: SPO0594 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: SPO0595 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: SPO0596 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: SPO0597 Name: usp Funciton: Universal stress family protein Locus tag: SPO0598 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
dctP-dctQ-dctM-hisD1-gno-sdh-usp-ldh	-292	5.6	GCGTGTAAGCGCTTGCATCG	SPO0591
	-270	6.9	AAATGTAAGCGCTTACATTG