Orthologous regulated operons containing hisD1 gene
| Regulog: | SPO0590 - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -130
Score: 5.11044 Sequence: AATTGTAATGGCTTGCATCG
Position: -107
Score: 5.71418 Sequence: TAATGTAAGGGCTTACACAC
Locus tag: Jann_1398
Name: hisD1 Funciton: putative histidinol dehydrogenase
Locus tag: Jann_1399
Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: Jann_1400
Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: Jann_1401
Name: comD Funciton: Sulfopyruvate decarboxylase - alpha subunit (EC 4.1.1.79)
Locus tag: Jann_1402
Name: comE Funciton: Sulfopyruvate decarboxylase - beta subunit (EC 4.1.1.79)
Locus tag: Jann_1403
Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3) |
||||
| hisD1-gno-sdh-comD-comE-ldh | -130 | 5.1 | AATTGTAATGGCTTGCATCG | Jann_1398 |
| -107 | 5.7 | TAATGTAAGGGCTTACACAC | ||
| Roseobacter sp. MED193 | ||||
|
Position: -298
Score: 6.08106 Sequence: CAATGTAAGGGCTTGCATAA
Position: -275
Score: 6.67598 Sequence: CCATGTAAGCGCTTACATTG
Locus tag: MED193_17079
Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component
Locus tag: MED193_17074
Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component
Locus tag: MED193_17069
Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component
Locus tag: MED193_17064
Name: hisD1 Funciton: putative histidinol dehydrogenase
Locus tag: MED193_17059
Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: MED193_17054
Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: MED193_17049
Name: usp Funciton: Universal stress family protein
Locus tag: MED193_17044
Name: comD Funciton: Sulfopyruvate decarboxylase - alpha subunit (EC 4.1.1.79)
Locus tag: MED193_17039
Name: comE Funciton: Sulfopyruvate decarboxylase - beta subunit (EC 4.1.1.79)
Locus tag: MED193_17034
Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3) |
||||
| dctP-dctQ-dctM-hisD1-gno-sdh-usp-comD-comE-ldh | -298 | 6.1 | CAATGTAAGGGCTTGCATAA | MED193_17079 |
| -275 | 6.7 | CCATGTAAGCGCTTACATTG | ||
| Roseovarius nubinhibens ISM | ||||
|
Position: -109
Score: 6.21981 Sequence: AAATGTAAGCGCTTGCAATA
Position: -86
Score: 6.50367 Sequence: CCATGCAAGCGCTTACATTG
Locus tag: ISM_05010
Name: hisD1 Funciton: putative histidinol dehydrogenase
Locus tag: ISM_05015
Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: ISM_05020
Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: ISM_05025
Name: usp Funciton: Universal stress family protein |
||||
| hisD1-gno-sdh-usp | -109 | 6.2 | AAATGTAAGCGCTTGCAATA | ISM_05010 |
| -86 | 6.5 | CCATGCAAGCGCTTACATTG | ||
| Roseovarius sp. 217 | ||||
|
Position: -265
Score: 6.64346 Sequence: ATATGTAAGCGCTTACATTT
Locus tag: ROS217_11206
Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component
Locus tag: ROS217_11211
Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component
Locus tag: ROS217_11216
Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component
Locus tag: ROS217_11221
Name: hisD1 Funciton: putative histidinol dehydrogenase
Locus tag: ROS217_11226
Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: ROS217_11231
Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: ROS217_11236
Name: usp Funciton: Universal stress family protein
Locus tag: ROS217_11241
Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3) |
||||
| dctP-dctQ-dctM-hisD1-gno-sdh-usp-ldh | -265 | 6.6 | ATATGTAAGCGCTTACATTT | ROS217_11206 |
| Silicibacter pomeroyi DSS-3 | ||||
|
Position: -292
Score: 5.60383 Sequence: GCGTGTAAGCGCTTGCATCG
Position: -270
Score: 6.85773 Sequence: AAATGTAAGCGCTTACATTG
Locus tag: SPO0591
Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component
Locus tag: SPO0592
Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component
Locus tag: SPO0593
Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component
Locus tag: SPO0594
Name: hisD1 Funciton: putative histidinol dehydrogenase
Locus tag: SPO0595
Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: SPO0596
Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: SPO0597
Name: usp Funciton: Universal stress family protein
Locus tag: SPO0598
Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3) |
||||
| dctP-dctQ-dctM-hisD1-gno-sdh-usp-ldh | -292 | 5.6 | GCGTGTAAGCGCTTGCATCG | SPO0591 |
| -270 | 6.9 | AAATGTAAGCGCTTACATTG | ||