Orthologous regulated operons containing afr gene
| Regulog: | AfrR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | 1,5-Anhydro-d-Fructose utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -58
Score: 5.54923 Sequence: ATTGTGGAACGTTCCAATTA
Position: -33
Score: 5.75692 Sequence: AAATCGGAACGTTCCAATTT
Locus tag: Jann_3940
Name: afr Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
Locus tag: Jann_3939
Name: null Funciton: coenzyme A transferase
Locus tag: Jann_3938
Name: null Funciton: enoyl-CoA hydratase
Locus tag: Jann_3937
Name: null Funciton: Betaine-aldehyde dehydrogenase EC=1.2.1.- |
||||
| afr-Jann_3939-Jann_3938-Jann_3937 | -58 | 5.5 | ATTGTGGAACGTTCCAATTA | Jann_3940 |
| -33 | 5.8 | AAATCGGAACGTTCCAATTT | ||