Orthologous regulated operons containing Jann_3924 gene
Regulog: | AfrR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | 1,5-Anhydro-d-Fructose utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Jannaschia sp. CCS1 | ||||
Position: -35
Score: 5.38035 Sequence: GAATTGGAACGTTCCAGAAG
Locus tag: Jann_3931
Name: null Funciton: FAD dependent oxidoreductase
Locus tag: Jann_3930
Name: null Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: Jann_3929
Name: sdh Funciton: L-sorbose 1-dehydrogenase EC=1.1.99.32
Locus tag: Jann_3928
Name: null Funciton: hypothetical protein
Locus tag: Jann_3927
Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
Locus tag: Jann_3926
Name: null Funciton: Hydroxypyruvate reductase
Locus tag: Jann_3925
Name: null Funciton: Stress responsive alpha-beta
Locus tag: Jann_3924
Name: null Funciton: hypothetical protein |
||||
Jann_3931-Jann_3930-sdh-Jann_3928-afrR-Jann_3926-Jann_3925-Jann_3924 | -35 | 5.4 | GAATTGGAACGTTCCAGAAG | Jann_3931 |