Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Jann_3925 gene

Properties
Regulog: AfrR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: 1,5-Anhydro-d-Fructose utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -35
Score: 5.38035
Sequence: GAATTGGAACGTTCCAGAAG
Locus tag: Jann_3931
Name: null
Funciton: FAD dependent oxidoreductase
Locus tag: Jann_3930
Name: null
Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: Jann_3929
Name: sdh
Funciton: L-sorbose 1-dehydrogenase EC=1.1.99.32
Locus tag: Jann_3928
Name: null
Funciton: hypothetical protein
Locus tag: Jann_3927
Name: afrR
Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
Locus tag: Jann_3926
Name: null
Funciton: Hydroxypyruvate reductase
Locus tag: Jann_3925
Name: null
Funciton: Stress responsive alpha-beta
Locus tag: Jann_3924
Name: null
Funciton: hypothetical protein
Jann_3931-Jann_3930-sdh-Jann_3928-afrR-Jann_3926-Jann_3925-Jann_3924 -35 5.4 GAATTGGAACGTTCCAGAAG Jann_3931