Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing merD gene

Properties
Regulog: MerR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella sp ANA-3
Position: -61
Score: 6.0836
Sequence: ACTCCGTACATCGGTACGGAGA
Locus tag: Shewana3_4314
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: Shewana3_4313
Name: merP
Funciton: Periplasmic mercury(+2) binding protein
Locus tag: Shewana3_4312
Name: merC
Funciton: Mercury uptake inner membane protein
Locus tag: Shewana3_4311
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: Shewana3_4310
Name: PF00563
Funciton: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s)
Locus tag: Shewana3_4309
Name: merD
Funciton: Mercuric resistance operon coregulator
merT-merP-merC-merA-PF00563-merD -61 6.1 ACTCCGTACATCGGTACGGAGA Shewana3_4314