Orthologous regulated operons containing merD gene
Regulog: | MerR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Mercury resistance |
Effector: | Mercury ion, (Hg2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella sp ANA-3 | ||||
Position: -61
Score: 6.0836 Sequence: ACTCCGTACATCGGTACGGAGA
Locus tag: Shewana3_4314
Name: merT Funciton: Mercury uptake inner membane protein
Locus tag: Shewana3_4313
Name: merP Funciton: Periplasmic mercury(+2) binding protein
Locus tag: Shewana3_4312
Name: merC Funciton: Mercury uptake inner membane protein
Locus tag: Shewana3_4311
Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: Shewana3_4310
Name: PF00563 Funciton: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s)
Locus tag: Shewana3_4309
Name: merD Funciton: Mercuric resistance operon coregulator |
||||
merT-merP-merC-merA-PF00563-merD | -61 | 6.1 | ACTCCGTACATCGGTACGGAGA | Shewana3_4314 |