Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing merA2 gene

Properties
Regulog: MerR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella sp ANA-3
Position: -63
Score: 6.32981
Sequence: ACTCCGTACATAACTACGGAAG
Locus tag: Shewana3_4342
Name: merT2
Funciton: Mercury uptake inner membane protein
Locus tag: Shewana3_4343
Name: merP2
Funciton: Periplasmic mercury (+2) binding protein
Locus tag: Shewana3_4344
Name: merC2
Funciton: Mercury uptake inner membane protein
Locus tag: Shewana3_4345
Name: merA2
Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: Shewana3_4346
Name: merD2
Funciton: Mercuric resistance operon coregulator
Locus tag: Shewana3_4347
Name: merE2
Funciton: Putative mercury resistance protein
merT2-merP2-merC2-merA2-merD2-merE2 -63 6.3 ACTCCGTACATAACTACGGAAG Shewana3_4342
© 2009-2020 RegPrecise