Orthologous regulated operons containing copC gene
| Regulog: | CueR - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Phenylobacterium zucineum HLK1 | ||||
|
Position: -129
Score: 6.14697 Sequence: ACCTTCCCACTATTGGAAGGT
Locus tag: PHZ_c1481
Name: copC Funciton: Copper resistance protein
Locus tag: PHZ_c1480
Name: copD Funciton: Putative copper export protein |
||||
| copC-copD | -129 | 6.1 | ACCTTCCCACTATTGGAAGGT | PHZ_c1481 |