Orthologous regulated operons containing cueR gene
| Regulog: | CueR - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter sp. K31 | ||||
|
Position: -56
Score: 5.63722 Sequence: ACCTTCCCATGATGGGAGGGA
Locus tag: Caul_2317
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Caul_2318
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -56 | 5.6 | ACCTTCCCATGATGGGAGGGA | Caul_2317 |
| Phenylobacterium zucineum HLK1 | ||||
|
Position: -59
Score: 6.00829 Sequence: ACCCTCCCATCATGGGAAGGT
Locus tag: PHZ_p0211
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: PHZ_p0210
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -59 | 6 | ACCCTCCCATCATGGGAAGGT | PHZ_p0211 |