Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing copA gene

Properties
Regulog: CueR - Sphingomonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Novosphingobium aromaticivorans DSM 12444
Position: -53
Score: 5.12449
Sequence: ACCCTGACATGATGTCAAGGT
Locus tag: Saro_2142
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Saro_2143
Name: PF11666
Funciton: hypothetical protein
Locus tag: Saro_2144
Name: cueR
Funciton: Copper-responsive transcriptional regulator, MerR family
copA-PF11666-cueR -53 5.1 ACCCTGACATGATGTCAAGGT Saro_2142
© 2009-2020 RegPrecise