Orthologous regulated operons containing copA gene
| Regulog: | CueR - Sphingomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Novosphingobium aromaticivorans DSM 12444 | ||||
|
Position: -53
Score: 5.12449 Sequence: ACCCTGACATGATGTCAAGGT
Locus tag: Saro_2142
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Saro_2143
Name: PF11666 Funciton: hypothetical protein
Locus tag: Saro_2144
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-PF11666-cueR | -53 | 5.1 | ACCCTGACATGATGTCAAGGT | Saro_2142 |