Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing copZ2 gene

Properties
Regulog: CueR - Rhodospirillales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Magnetospirillum magnetotacticum MS-1
Position: -58
Score: 5.40546
Sequence: ACCTTCCCACCATGGGAACGA
Locus tag: Magn03006555
Name: copZ2
Funciton: Copper chaperone
copZ2 -58 5.4 ACCTTCCCACCATGGGAACGA Magn03006555
© 2009-2020 RegPrecise