Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing copA2 gene

Properties
Regulog: CueR - Rhodospirillales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Magnetospirillum magnetotacticum MS-1
Position: -127
Score: 5.08284
Sequence: ACCTTCCCATTGTAGGAAGCC
Locus tag: Magn03006556
Name: copA2
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copA2 -127 5.1 ACCTTCCCATTGTAGGAAGCC Magn03006556