Orthologous regulated operons containing cueR gene
| Regulog: | CueR - Rhodospirillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azospirillum sp. B510 | ||||
|
Position: -62
Score: 4.90964 Sequence: ACCTTCCAGCGGCTGGAAGCC
Locus tag: AZL_a03850
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: AZL_a03860
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -62 | 4.9 | ACCTTCCAGCGGCTGGAAGCC | AZL_a03850 |
| Magnetospirillum magneticum AMB-1 | ||||
|
Position: -26
Score: 5.89365 Sequence: ACCTTCCCGTTGCTGGAAGGT
Locus tag: amb1807
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: amb1808
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -26 | 5.9 | ACCTTCCCGTTGCTGGAAGGT | amb1807 |
| Magnetospirillum magnetotacticum MS-1 | ||||
|
Position: -60
Score: 5.79722 Sequence: ACCTTCCAGTGACTGGAAGGT
Locus tag: Magn03009759
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Magn03009758
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -60 | 5.8 | ACCTTCCAGTGACTGGAAGGT | Magn03009759 |