Orthologous regulated operons containing SMb0013 gene
Regulog: | SMb20014 - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Mesorhizobium sp. BNC1 | ||||
Position: -37
Score: 6.0896 Sequence: AATTGAAATCGATTTCATCG
Locus tag: Meso_0266
Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: Meso_0265
Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: Meso_0264
Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Meso_0263
Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Meso_0262
Name: SMb20014 Funciton: Transcriptional regulator, LacI family
Locus tag: Meso_0261
Name: SMb0013 Funciton: Dehydrogenase, putative |
||||
SMc20018-SMc20017-SMb20016-SMb20015-SMb20014-SMb0013 | -37 | 6.1 | AATTGAAATCGATTTCATCG | Meso_0266 |
Rhizobium sp. NGR234 | ||||
Position: -59
Score: 6.0968 Sequence: CATTGAAATCGATTACATTT
Locus tag: NGR_b02560
Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: NGR_b02570
Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: NGR_b02580
Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: NGR_b02590
Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: NGR_b02600
Name: SMb20014 Funciton: Transcriptional regulator, LacI family
Locus tag: NGR_b02610
Name: SMb0013 Funciton: Dehydrogenase, putative |
||||
SMc20018-SMc20017-SMb20016-SMb20015-SMb20014-SMb0013 | -59 | 6.1 | CATTGAAATCGATTACATTT | NGR_b02560 |
Sinorhizobium meliloti 1021 | ||||
Position: -57
Score: 5.96108 Sequence: GATTGAAATCGATTACATTT
Locus tag: SMb20018
Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: SMb20017
Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: SMb20016
Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: SMb20015
Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: SMb20014
Name: SMb20014 Funciton: Transcriptional regulator, LacI family
Locus tag: SMb20013
Name: SMb0013 Funciton: Dehydrogenase, putative |
||||
SMc20018-SMc20017-SMb20016-SMb20015-SMb20014-SMb0013 | -57 | 6 | GATTGAAATCGATTACATTT | SMb20018 |