Orthologous regulated operons containing SMb0013 gene

Properties
Regulog:	SMb20014 - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mesorhizobium sp. BNC1
Position: -37 Score: 6.0896 Sequence: AATTGAAATCGATTTCATCG Locus tag: Meso_0266 Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Meso_0265 Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Meso_0264 Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Meso_0263 Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Meso_0262 Name: SMb20014 Funciton: Transcriptional regulator, LacI family Locus tag: Meso_0261 Name: SMb0013 Funciton: Dehydrogenase, putative
SMc20018-SMc20017-SMb20016-SMb20015-SMb20014-SMb0013	-37	6.1	AATTGAAATCGATTTCATCG	Meso_0266
Rhizobium sp. NGR234
Position: -59 Score: 6.0968 Sequence: CATTGAAATCGATTACATTT Locus tag: NGR_b02560 Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: NGR_b02570 Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: NGR_b02580 Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: NGR_b02590 Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: NGR_b02600 Name: SMb20014 Funciton: Transcriptional regulator, LacI family Locus tag: NGR_b02610 Name: SMb0013 Funciton: Dehydrogenase, putative
SMc20018-SMc20017-SMb20016-SMb20015-SMb20014-SMb0013	-59	6.1	CATTGAAATCGATTACATTT	NGR_b02560
Sinorhizobium meliloti 1021
Position: -57 Score: 5.96108 Sequence: GATTGAAATCGATTACATTT Locus tag: SMb20018 Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: SMb20017 Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: SMb20016 Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMb20015 Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMb20014 Name: SMb20014 Funciton: Transcriptional regulator, LacI family Locus tag: SMb20013 Name: SMb0013 Funciton: Dehydrogenase, putative
SMc20018-SMc20017-SMb20016-SMb20015-SMb20014-SMb0013	-57	6	GATTGAAATCGATTACATTT	SMb20018