Orthologous regulated operons containing thl3 gene

Properties
Regulog:	BglR2 - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Phylum:	Proteobacteria/Alpha

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -273 Score: 6.40853 Sequence: AAATGACAACGTTGACATTC Locus tag: CC0970 Name: omp(Bgl)2 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: CC0971 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: CC0972 Name: thl3 Funciton: tryptophan halogenase, putative
omp(Bgl)2-thl2-thl3	-273	6.4	AAATGACAACGTTGACATTC	CC0970
Caulobacter segnis ATCC 21756
Position: -270 Score: 6.14052 Sequence: CAATGACAACGTTGACATTC Locus tag: Cseg_3734 Name: omp(Bgl)2 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: Cseg_3733 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: Cseg_3732 Name: thl3 Funciton: tryptophan halogenase, putative
omp(Bgl)2-thl2-thl3	-270	6.1	CAATGACAACGTTGACATTC	Cseg_3734
Caulobacter sp. K31
Position: -242 Score: 6.38727 Sequence: AAATGACAACGTTGACATTT Locus tag: Caul_2142 Name: omp(Bgl)2 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: Caul_2143 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: Caul_2144 Name: thl3 Funciton: tryptophan halogenase, putative
omp(Bgl)2-thl2-thl3	-242	6.4	AAATGACAACGTTGACATTT	Caul_2142

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --