Orthologous regulated operons containing ROS217_02325 gene
| Regulog: | CueR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Roseovarius sp. 217 | ||||
|
Position: -61
Score: 4.76169 Sequence: ACCTTCCAGTTACAGGAACCT
Locus tag: ROS217_02315
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: ROS217_02320
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
Locus tag: ROS217_02325
Name: null Funciton: hypothetical protein |
||||
| copA-cueR-ROS217_02325 | -61 | 4.8 | ACCTTCCAGTTACAGGAACCT | ROS217_02315 |