Orthologous regulated operons containing copA gene
| Regulog: | CueR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -54
Score: 5.54911 Sequence: AGCTTCCAGTCACTGGAAGGT
Locus tag: Jann_2086
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Jann_2087
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -54 | 5.5 | AGCTTCCAGTCACTGGAAGGT | Jann_2086 |
| Oceanicola batsensis HTCC2597 | ||||
|
Position: -58
Score: 4.78538 Sequence: ACCCTCCAGTAACTGGAAGCC
Locus tag: OB2597_16487
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: OB2597_16492
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -58 | 4.8 | ACCCTCCAGTAACTGGAAGCC | OB2597_16487 |
| Rhodobacter sphaeroides 2.4.1 | ||||
|
Position: -48
Score: 5.30264 Sequence: ACCTTCCAGTTGTGGGAAGCC
Locus tag: RSP_2890
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: RSP_2889
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -48 | 5.3 | ACCTTCCAGTTGTGGGAAGCC | RSP_2890 |
| Roseobacter sp. MED193 | ||||
|
Position: -36
Score: 4.68391 Sequence: ACCTTCCGGTAACTGGAAGCC
Locus tag: MED193_02420
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: MED193_02425
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -36 | 4.7 | ACCTTCCGGTAACTGGAAGCC | MED193_02420 |
| Roseovarius nubinhibens ISM | ||||
|
Position: -128
Score: 5.03155 Sequence: ACCTTCCAGTTGCTGGAAGCC
Locus tag: ISM_17435
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) |
||||
| copA | -128 | 5 | ACCTTCCAGTTGCTGGAAGCC | ISM_17435 |
| Roseovarius sp. 217 | ||||
|
Position: -55
Score: 5.0862 Sequence: ACCTTCCAGTTGGTGGAAGCC
Locus tag: ROS217_03395
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: ROS217_03400
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
Locus tag: ROS217_03405
Name: PF07885 Funciton: Hypothetical membrane protein |
||||
| copA-cueR-PF07885 | -55 | 5.1 | ACCTTCCAGTTGGTGGAAGCC | ROS217_03395 |
| Silicibacter pomeroyi DSS-3 | ||||
|
Position: -58
Score: 4.74607 Sequence: ACCTTCCCGTGACTGGAACCC
Locus tag: SPO0794
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: SPO0793
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -58 | 4.7 | ACCTTCCCGTGACTGGAACCC | SPO0794 |
| Sulfitobacter sp. EE-36 | ||||
|
Position: -114
Score: 4.97128 Sequence: ACCTTCCATTAACTGGAAGCC
Locus tag: EE36_05438
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: EE36_05433
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -114 | 5 | ACCTTCCATTAACTGGAAGCC | EE36_05438 |