Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PHZ_c2151 gene

Properties
Regulog: CC1627 - Caulobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Phenylobacterium zucineum HLK1
Position: -67
Score: 5.36433
Sequence: ACGTGTAATCGATTACATCG
Locus tag: PHZ_c2157
Name: null
Funciton: nucleoside:H symporter
Locus tag: PHZ_c2156
Name: null
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: PHZ_c2155
Name: null
Funciton: Oxidoreductase (EC 1.1.1.-)
Locus tag: PHZ_c2154
Name: null
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: PHZ_c2153
Name: null
Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: PHZ_c2152
Name: null
Funciton: hypothetical protein
Locus tag: PHZ_c2151
Name: null
Funciton: hypothetical protein
PHZ_c2157-PHZ_c2156-PHZ_c2155-PHZ_c2154-PHZ_c2153-PHZ_c2152-PHZ_c2151 -67 5.4 ACGTGTAATCGATTACATCG PHZ_c2157
© 2009-2020 RegPrecise