Orthologous regulated operons containing CC1635 gene
| Regulog: | CC1627 - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -117
Score: 4.71282 Sequence: CAATGTAACCCATTTCATGG
Locus tag: CC1634
Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: CC1635
Name: null Funciton: hypothetical protein |
||||
| CC1634-CC1635 | -117 | 4.7 | CAATGTAACCCATTTCATGG | CC1634 |
| Caulobacter segnis ATCC 21756 | ||||
|
Position: -119
Score: 4.71282 Sequence: CAATGTAACCCATTTCATGG
Locus tag: Cseg_2107
Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: Cseg_2106
Name: null Funciton: hypothetical protein |
||||
| Cseg_2107-Cseg_2106 | -119 | 4.7 | CAATGTAACCCATTTCATGG | Cseg_2107 |
| Caulobacter sp. K31 | ||||
|
Position: -118
Score: 4.71282 Sequence: CAATGTAACCCATTTCATGG
Locus tag: Caul_4606
Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: Caul_4605
Name: null Funciton: hypothetical protein |
||||
| Caul_4606-Caul_4605 | -118 | 4.7 | CAATGTAACCCATTTCATGG | Caul_4606 |
| Phenylobacterium zucineum HLK1 | ||||
|
Position: -67
Score: 5.36433 Sequence: ACGTGTAATCGATTACATCG
Locus tag: PHZ_c2157
Name: null Funciton: nucleoside:H symporter
Locus tag: PHZ_c2156
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: PHZ_c2155
Name: null Funciton: Oxidoreductase (EC 1.1.1.-)
Locus tag: PHZ_c2154
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: PHZ_c2153
Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: PHZ_c2152
Name: null Funciton: hypothetical protein
Locus tag: PHZ_c2151
Name: null Funciton: hypothetical protein |
||||
| PHZ_c2157-PHZ_c2156-PHZ_c2155-PHZ_c2154-PHZ_c2153-PHZ_c2152-PHZ_c2151 | -67 | 5.4 | ACGTGTAATCGATTACATCG | PHZ_c2157 |