Orthologous regulated operons containing CC1629 gene
Regulog: | CC1627 - Caulobacterales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Caulobacter crescentus CB15 | ||||
Position: -81
Score: 4.72593 Sequence: CGATGAATTCGATTACATTG
Locus tag: CC1628
Name: null Funciton: nucleoside:H symporter
Locus tag: CC1629
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: CC1630
Name: null Funciton: Oxidoreductase (EC 1.1.1.-)
Locus tag: CC1631
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: CC1632
Name: cyc Funciton: Cytochrome c2 |
||||
CC1628-CC1629-CC1630-CC1631-cyc | -81 | 4.7 | CGATGAATTCGATTACATTG | CC1628 |
Caulobacter segnis ATCC 21756 | ||||
Position: -81
Score: 4.40495 Sequence: CGATGATTTCGATTACATCG
Locus tag: Cseg_2113
Name: null Funciton: nucleoside:H symporter
Locus tag: Cseg_2112
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Cseg_2111
Name: null Funciton: Oxidoreductase (EC 1.1.1.-)
Locus tag: Cseg_2110
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Cseg_2109
Name: cyc Funciton: Cytochrome c2 |
||||
Cseg_2113-Cseg_2112-Cseg_2111-Cseg_2110-cyc | -81 | 4.4 | CGATGATTTCGATTACATCG | Cseg_2113 |
Caulobacter sp. K31 | ||||
Position: -83
Score: 4.3289 Sequence: CGATGATTTCGATTACATCA
Locus tag: Caul_4612
Name: null Funciton: nucleoside:H symporter
Locus tag: Caul_4611
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Caul_4610
Name: null Funciton: Oxidoreductase (EC 1.1.1.-)
Locus tag: Caul_4609
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Caul_4608
Name: cyc Funciton: Cytochrome c2 |
||||
Caul_4612-Caul_4611-Caul_4610-Caul_4609-cyc | -83 | 4.3 | CGATGATTTCGATTACATCA | Caul_4612 |
Phenylobacterium zucineum HLK1 | ||||
Position: -67
Score: 5.36433 Sequence: ACGTGTAATCGATTACATCG
Locus tag: PHZ_c2157
Name: null Funciton: nucleoside:H symporter
Locus tag: PHZ_c2156
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: PHZ_c2155
Name: null Funciton: Oxidoreductase (EC 1.1.1.-)
Locus tag: PHZ_c2154
Name: null Funciton: Sugar phosphate isomerases/epimerases
Locus tag: PHZ_c2153
Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: PHZ_c2152
Name: null Funciton: hypothetical protein
Locus tag: PHZ_c2151
Name: null Funciton: hypothetical protein |
||||
PHZ_c2157-PHZ_c2156-PHZ_c2155-PHZ_c2154-PHZ_c2153-PHZ_c2152-PHZ_c2151 | -67 | 5.4 | ACGTGTAATCGATTACATCG | PHZ_c2157 |