Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing copA2 gene

Properties
Regulog: CueR - Burkholderia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia vietnamiensis G4
Position: -26
Score: 6.2914
Sequence: ACCTTCCCATAGTGGGAAGGT
Locus tag: Bcep1808_3973
Name: cueR2
Funciton: Copper-responsive transcriptional regulator, MerR family
Locus tag: Bcep1808_3972
Name: copA2
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR2-copA2 -26 6.3 ACCTTCCCATAGTGGGAAGGT Bcep1808_3973