Orthologous regulated operons containing SMc04260 gene
| Regulog: | SMc04260 - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mesorhizobium loti MAFF303099 | ||||
|
Position: -116
Score: 5.74518 Sequence: AATCTGTAACGTTTCAGTAT
Locus tag: mlr3320
Name: SMc04260 Funciton: Transcriptional regulator, LacI family |
||||
| SMc04260 | -116 | 5.7 | AATCTGTAACGTTTCAGTAT | mlr3320 |
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -119
Score: 5.60457 Sequence: CTACTGTATCGTTACAGATT
Locus tag: RL2797
Name: SMc04260 Funciton: Transcriptional regulator, LacI family |
||||
| SMc04260 | -119 | 5.6 | CTACTGTATCGTTACAGATT | RL2797 |
| Rhizobium sp. NGR234 | ||||
|
Position: -175
Score: 5.62812 Sequence: CTACTGTATCGTTACAGATA
Locus tag: NGR_c17850
Name: SMc04260 Funciton: Transcriptional regulator, LacI family |
||||
| SMc04260 | -175 | 5.6 | CTACTGTATCGTTACAGATA | NGR_c17850 |
| Sinorhizobium meliloti 1021 | ||||
|
Position: -143
Score: 5.60457 Sequence: CTACTGTATCGTTACAGATT
Locus tag: SMc04260
Name: SMc04260 Funciton: Transcriptional regulator, LacI family |
||||
| SMc04260 | -143 | 5.6 | CTACTGTATCGTTACAGATT | SMc04260 |