Orthologous regulated operons containing COG0673 gene

Properties
Regulog:	SMc04260 - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -28 Score: 5.58138 Sequence: TGACTGTAACGTTACAGGAG Locus tag: Atu3351 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Atu3350 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Atu3349 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Atu3348 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: Atu3347 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
SMc04258-SMc04257-SMc04256-COG1082-COG0673	-28	5.6	TGACTGTAACGTTACAGGAG	Atu3351
Mesorhizobium loti MAFF303099
Position: -35 Score: 5.56701 Sequence: AATCTGTAACGTTTCAGATT Locus tag: mll3319 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: mll3316 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mll3315 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mll3314 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: mll3313 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: mll3311 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
SMc04259-SMc04258-SMc04257-SMc04256-COG1082-COG0673	-35	5.6	AATCTGTAACGTTTCAGATT	mll3319
Rhizobium leguminosarum bv. viciae 3841
Position: -33 Score: 5.43618 Sequence: TTCCGGCAACGTTTCAGTGA Locus tag: RL2796 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: RL2795 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RL2794 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RL2793 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: RL2792 Name: null Funciton: Beta-mannosidase (EC 3.2.1.25) Locus tag: RL2791 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: RL2790 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
SMc04259-SMc04258-SMc04257-SMc04256-RL2792-COG1082-COG0673	-33	5.4	TTCCGGCAACGTTTCAGTGA	RL2796
Sinorhizobium meliloti 1021
Position: -32 Score: 5.71385 Sequence: TTACGGCAACGTTACAGTGA Locus tag: SMc04259 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: SMc04258 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMc04257 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMc04256 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: SMc04255 Name: manB Funciton: Beta-mannosidase (EC 3.2.1.25) Locus tag: SMc04254 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: SMc04253 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
SMc04259-SMc04258-SMc04257-SMc04256-manB-COG1082-COG0673	-32	5.7	TTACGGCAACGTTACAGTGA	SMc04259