Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing COG1082 gene

Properties
Regulog: SMc04260 - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 15 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -28
Score: 5.58138
Sequence: TGACTGTAACGTTACAGGAG
Locus tag: Atu3351
Name: SMc04258
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Atu3350
Name: SMc04257
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Atu3349
Name: SMc04256
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: Atu3348
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Atu3347
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
SMc04258-SMc04257-SMc04256-COG1082-COG0673 -28 5.6 TGACTGTAACGTTACAGGAG Atu3351
Mesorhizobium loti MAFF303099
Position: -35
Score: 5.56701
Sequence: AATCTGTAACGTTTCAGATT
Locus tag: mll3319
Name: SMc04259
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: mll3316
Name: SMc04258
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: mll3315
Name: SMc04257
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: mll3314
Name: SMc04256
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: mll3313
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: mll3311
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
SMc04259-SMc04258-SMc04257-SMc04256-COG1082-COG0673 -35 5.6 AATCTGTAACGTTTCAGATT mll3319
Rhizobium leguminosarum bv. viciae 3841
Position: -33
Score: 5.43618
Sequence: TTCCGGCAACGTTTCAGTGA
Locus tag: RL2796
Name: SMc04259
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: RL2795
Name: SMc04258
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RL2794
Name: SMc04257
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RL2793
Name: SMc04256
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: RL2792
Name: null
Funciton: Beta-mannosidase (EC 3.2.1.25)
Locus tag: RL2791
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: RL2790
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
SMc04259-SMc04258-SMc04257-SMc04256-RL2792-COG1082-COG0673 -33 5.4 TTCCGGCAACGTTTCAGTGA RL2796
Sinorhizobium meliloti 1021
Position: -32
Score: 5.71385
Sequence: TTACGGCAACGTTACAGTGA
Locus tag: SMc04259
Name: SMc04259
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: SMc04258
Name: SMc04258
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: SMc04257
Name: SMc04257
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: SMc04256
Name: SMc04256
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: SMc04255
Name: manB
Funciton: Beta-mannosidase (EC 3.2.1.25)
Locus tag: SMc04254
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: SMc04253
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
SMc04259-SMc04258-SMc04257-SMc04256-manB-COG1082-COG0673 -32 5.7 TTACGGCAACGTTACAGTGA SMc04259