Orthologous regulated operons containing manA gene
| Regulog: | SMc04260 - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -150
Score: 5.53351 Sequence: TTACGGTAACGTTGCCGGAG
Locus tag: Atu1523
Name: manA Funciton: Beta-mannosidase (EC 3.2.1.25) |
||||
| manA | -150 | 5.5 | TTACGGTAACGTTGCCGGAG | Atu1523 |
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -33
Score: 5.43618 Sequence: TTCCGGCAACGTTTCAGTGA
Locus tag: RL2796
Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: RL2795
Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RL2794
Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RL2793
Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: RL2792
Name: null Funciton: Beta-mannosidase (EC 3.2.1.25)
Locus tag: RL2791
Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
Locus tag: RL2790
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins |
||||
| SMc04259-SMc04258-SMc04257-SMc04256-RL2792-COG1082-COG0673 | -33 | 5.4 | TTCCGGCAACGTTTCAGTGA | RL2796 |
| Sinorhizobium meliloti 1021 | ||||
|
Position: -32
Score: 5.71385 Sequence: TTACGGCAACGTTACAGTGA
Locus tag: SMc04259
Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: SMc04258
Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: SMc04257
Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: SMc04256
Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: SMc04255
Name: manB Funciton: Beta-mannosidase (EC 3.2.1.25)
Locus tag: SMc04254
Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
Locus tag: SMc04253
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins |
||||
| SMc04259-SMc04258-SMc04257-SMc04256-manB-COG1082-COG0673 | -32 | 5.7 | TTACGGCAACGTTACAGTGA | SMc04259 |