Orthologous regulated operons containing RL4252 gene
| Regulog: | Jann_3936 - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -192
Score: 5.54559 Sequence: GATTTTAAACGTTTCAATAG
Position: -63
Score: 6.41471 Sequence: GATTTATAACGTTTTAATTC
Locus tag: Jann_3935
Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component
Locus tag: Jann_3934
Name: RL4251 Funciton: sugar ABC transporter, permease protein
Locus tag: Jann_3933
Name: RL4250 Funciton: putative ABC transporter, permease protein
Locus tag: Jann_3932
Name: null Funciton: sugar ABC transporter, ATP-binding protein |
||||
| RL4252-RL4251-RL4250-Jann_3932 | -192 | 5.5 | GATTTTAAACGTTTCAATAG | Jann_3935 |
| -63 | 6.4 | GATTTATAACGTTTTAATTC | ||