Orthologous regulated operons containing SMb20630 gene
Regulog: | SMb21706 - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Rhizobium etli CFN 42 | ||||
Position: -182
Score: 6.60819 Sequence: ATGAGAAAACCTTTTCTCAC
Position: -150
Score: 6.21307 Sequence: TTGGTAAAAGCTTTTCTCAA
Locus tag: RHE_CH03845
Name: SMb21706 Funciton: Transcriptional regulator, LacI family
Locus tag: RHE_CH03844
Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein
Locus tag: RHE_CH03843
Name: SMb20633 Funciton: sugar ABC transporter, permease protein
Locus tag: RHE_CH03842
Name: SMb20632 Funciton: sugar ABC transporter, permease protein
Locus tag: RHE_CH03841
Name: PF07944 Funciton: Protein of unknown function DUF1680
Locus tag: RHE_CH03840
Name: SMb20630 Funciton: sugar ABC transporter, ATP binding protein |
||||
SMb21706-SMb20634-SMb20633-SMb20632-PF07944-SMb20630 | -182 | 6.6 | ATGAGAAAACCTTTTCTCAC | RHE_CH03845 |
-150 | 6.2 | TTGGTAAAAGCTTTTCTCAA | ||
Rhizobium leguminosarum bv. viciae 3841 | ||||
Position: -71
Score: 6.60819 Sequence: ATGAGAAAACCTTTTCTCAC
Position: -39
Score: 6.05395 Sequence: TTGGTAAAAGCTTTTCTCAG
Locus tag: RL4378
Name: SMb21706 Funciton: Transcriptional regulator, LacI family
Locus tag: RL4377
Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein
Locus tag: RL4376
Name: SMb20633 Funciton: sugar ABC transporter, permease protein
Locus tag: RL4375
Name: SMb20632 Funciton: sugar ABC transporter, permease protein
Locus tag: RL4374
Name: PF07944 Funciton: Protein of unknown function DUF1680
Locus tag: RL4373
Name: SMb20630 Funciton: sugar ABC transporter, ATP binding protein |
||||
SMb21706-SMb20634-SMb20633-SMb20632-PF07944-SMb20630 | -71 | 6.6 | ATGAGAAAACCTTTTCTCAC | RL4378 |
-39 | 6.1 | TTGGTAAAAGCTTTTCTCAG | ||
Sinorhizobium meliloti 1021 | ||||
Position: -297
Score: 6.51017 Sequence: GTGAGAAAACCTTTTCTCAG
Position: -264
Score: 6.72782 Sequence: TTGAGAAAAGGTTTTCTCAT
Locus tag: SMb21706
Name: SMb21706 Funciton: Transcriptional regulator, LacI family
Locus tag: SMb20634
Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein
Locus tag: SMb20633
Name: SMb20633 Funciton: sugar ABC transporter, permease protein
Locus tag: SMb20632
Name: SMb20632 Funciton: sugar ABC transporter, permease protein
Locus tag: SMb20631
Name: PF07944 Funciton: Protein of unknown function DUF1680
Locus tag: SMb20630
Name: SMb20630 Funciton: sugar ABC transporter, ATP binding protein |
||||
SMb21706-SMb20634-SMb20633-SMb20632-PF07944-SMb20630 | -297 | 6.5 | GTGAGAAAACCTTTTCTCAG | SMb21706 |
-264 | 6.7 | TTGAGAAAAGGTTTTCTCAT |