Orthologous regulated operons containing gntK gene
| Regulog: | GntR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Xanthobacter autotrophicus Py2 | ||||
|
Position: -204
Score: 5.8444 Sequence: ATAAGATAACGCTATCTTGA
Position: -61
Score: 6.29553 Sequence: GAAAGACAGCGCTATCTCAG
Locus tag: Xaut_1235
Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) |
||||
| gntK | -204 | 5.8 | ATAAGATAACGCTATCTTGA | Xaut_1235 |
| -61 | 6.3 | GAAAGACAGCGCTATCTCAG | ||