Orthologous regulated operons containing gntZ gene
Regulog: | GntR - Rhodospirillales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Gluconate utilization |
Effector: | Gluconate |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Azospirillum sp. B510 | ||||
Position: -138
Score: 5.58386 Sequence: CAAGGTTAGCGCTAACAGTA
Position: -48
Score: 6.08558 Sequence: TCATGATAGCGCTAACATAA
Locus tag: AZL_d00380
Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: AZL_d00390
Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: AZL_d00400
Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: AZL_d00410
Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit |
||||
gntK-gntZ-gntY-gntX | -138 | 5.6 | CAAGGTTAGCGCTAACAGTA | AZL_d00380 |
-48 | 6.1 | TCATGATAGCGCTAACATAA |