Orthologous regulated operons containing gntU gene

Properties
Regulog:	GntR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Phylum:	Proteobacteria/gamma

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chromohalobacter salexigens DSM 3043
Position: -107 Score: 6.2674 Sequence: GAATGTTACCGGTAACATTC Position: -40 Score: 4.47138 Sequence: CCTCGTTGCCGGTCGCGCCT Locus tag: Csal_0925 Name: gntU Funciton: Low-affinity gluconate transporter
gntU	-107	6.3	GAATGTTACCGGTAACATTC	Csal_0925
	-40	4.5	CCTCGTTGCCGGTCGCGCCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --