Orthologous regulated operons containing gntR gene
| Regulog: | GntR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -53
Score: 5.55038 Sequence: GAACGTTACCGCTAACATCG
Locus tag: Csal_0927
Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family |
||||
| gntR | -53 | 5.6 | GAACGTTACCGCTAACATCG | Csal_0927 |
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -129
Score: 5.63238 Sequence: AAAAGTTACCGGTAACAAAT
Position: -103
Score: 5.97956 Sequence: GAATGTTACCGGTAACACGC
Locus tag: HCH_03539
Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: HCH_03541
Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: HCH_03542
Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: HCH_03543
Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: HCH_03544
Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family |
||||
| gntX-gntY-gntZ-gntK-gntR | -129 | 5.6 | AAAAGTTACCGGTAACAAAT | HCH_03539 |
| -103 | 6 | GAATGTTACCGGTAACACGC | ||
| Marinomonas sp. MWYL1 | ||||
|
Position: -123
Score: 5.62373 Sequence: AAATGTTATCGGTAACATCA
Position: -100
Score: 5.65655 Sequence: TCTAGTTACCGGTAACATTT
Locus tag: Mmwyl1_0698
Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: Mmwyl1_0697
Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: Mmwyl1_0696
Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: Mmwyl1_0695
Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: Mmwyl1_0694
Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family |
||||
| gntX-gntY-gntZ-gntK-gntR | -123 | 5.6 | AAATGTTATCGGTAACATCA | Mmwyl1_0698 |
| -100 | 5.7 | TCTAGTTACCGGTAACATTT | ||