Orthologous regulated operons containing gntR gene
| Regulog: | GntR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudoalteromonas haloplanktis TAC125 | ||||
|
Position: -97
Score: 6.54137 Sequence: TTATGTTACGTGTAACATAA
Locus tag: PSHAb0478
Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family |
||||
| gntR | -97 | 6.5 | TTATGTTACGTGTAACATAA | PSHAb0478 |