Orthologous regulated operons containing gntK gene
Regulog: | GntR - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Gluconate utilization |
Effector: | Gluconate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pseudoalteromonas haloplanktis TAC125 | ||||
Position: -90
Score: 6.57794 Sequence: TTAAGTTACGCGTAACATGT
Position: -76
Score: 6.29242 Sequence: ACATGTTACCAGTAACTTAA
Locus tag: PSHAb0480
Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) |
||||
gntK | -90 | 6.6 | TTAAGTTACGCGTAACATGT | PSHAb0480 |
-76 | 6.3 | ACATGTTACCAGTAACTTAA |