Orthologous regulated operons containing gntY gene
| Regulog: | GntR - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Psychromonas ingrahamii 37 | ||||
|
Position: -98
Score: 5.99049 Sequence: GTAAGTTACCGGTAACATTC
Position: -76
Score: 5.19872 Sequence: ATCAGTTACCGGTAACCTAT
Locus tag: Ping_2933
Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: Ping_2934
Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: Ping_2935
Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: Ping_2936
Name: gntK2 Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: Ping_2937
Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44) |
||||
| gntX-gntY-gntZ-gntK2-gnd | -98 | 6 | GTAAGTTACCGGTAACATTC | Ping_2933 |
| -76 | 5.2 | ATCAGTTACCGGTAACCTAT | ||